Review



transferrin receptor 1 (mab df1513  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Millipore transferrin receptor 1 (mab df1513
    Primer sequences.
    Transferrin Receptor 1 (Mab Df1513, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/transferrin+receptor+1+(mab+df1513/df+1513+antibody/pmc02773926-110-16-21
    Average 90 stars, based on 1 article reviews
    transferrin receptor 1 (mab df1513 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Evidence for a Lack of a Direct Transcriptional Suppression of the Iron Regulatory Peptide Hepcidin by Hypoxia-Inducible Factors"

    Article Title: Evidence for a Lack of a Direct Transcriptional Suppression of the Iron Regulatory Peptide Hepcidin by Hypoxia-Inducible Factors

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0007875

    Primer sequences.
    Figure Legend Snippet: Primer sequences.

    Techniques Used: Clone Assay, Construct, Quantitative RT-PCR

    Related Articles

    Western Blot:

    Article Title: Evidence for a Lack of a Direct Transcriptional Suppression of the Iron Regulatory Peptide Hepcidin by Hypoxia-Inducible Factors
    Article Snippet: For TfR1 knock-down three independent siRNAs were used (sense strands): TfR1_A 5′GGAAUAAGGCCUUAAUAUG , TfR1_B 5′GGUACAACAGCCAACUGCU , and Hs_TFRC_5 no. SI00301896 ( 5′AAGUAGAUGGCGAUAACAGUC , Qiagen). .. Immunoblotting for HIF-1α (rabbit antiserum NB100–449, Novus Biologicals, USA), HIF-2α (mouse monoclonal antibody (mab) NB100–132) and transferrin receptor 1 (mab DF1513, Sigma) was performed as described previously . .. Quantification of signals was performed using a Phosphoimager (FujiBAS 2000, Fuji) and the AIDA image analysis software (Raytest).



    Similar Products

    transferrin receptor 1 (mab df1513  (Millipore)
    90
    Millipore transferrin receptor 1 (mab df1513
    Primer sequences.
    Transferrin Receptor 1 (Mab Df1513, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/transferrin+receptor+1+(mab+df1513/df+1513+antibody/pmc02773926-110-16-21
    Average 90 stars, based on 1 article reviews
    transferrin receptor 1 (mab df1513 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Primer sequences.

    Journal: PLoS ONE

    Article Title: Evidence for a Lack of a Direct Transcriptional Suppression of the Iron Regulatory Peptide Hepcidin by Hypoxia-Inducible Factors

    doi: 10.1371/journal.pone.0007875

    Figure Lengend Snippet: Primer sequences.

    Article Snippet: Immunoblotting for HIF-1α (rabbit antiserum NB100–449, Novus Biologicals, USA), HIF-2α (mouse monoclonal antibody (mab) NB100–132) and transferrin receptor 1 (mab DF1513, Sigma) was performed as described previously .

    Techniques: Clone Assay, Construct, Quantitative RT-PCR